tle2

Ensembl ID:
ENSDARG00000042484
ZFIN ID:
ZDB-GENE-030131-2826
Description:
si:ch211-81i17.1 [Source:RefSeq peptide;Acc:NP_001124076]
Human Orthologues:
AC010547.1, AES, TLE2, TLE6
Human Descriptions:
amino-terminal enhancer of split [Source:HGNC Symbol;Acc:307]
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:11838]
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:30788]
Mouse Orthologues:
Aes, Tle2, Tle6
Mouse Descriptions:
amino-terminal enhancer of split Gene [Source:MGI Symbol;Acc:MGI:95806]
transducin-like enhancer of split 2, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:10
transducin-like enhancer of split 6, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9041 Nonsense Mutation detected in F1 DNA During 2014
sa12775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105553 Nonsense 366 811 12 20
ENSDART00000133939 Nonsense 366 810 12 20
Genomic Location:
Chromosome 22 (position 21981755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGWCCAGCACTCCAGGGATGAAGCCTGGAACGCCCATGTCCCAGGAGT[C/A]GTCCACTCCAGGCCCCAGCGTTCCTCCACAGTTTCGTCCTGTTCCTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105553 Essential Splice Site 390 811 12 20
ENSDART00000133939 Essential Splice Site 390 810 12 20
Genomic Location:
Chromosome 22 (position 21981828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCACAGTTTCGTCCTGTTCCTGGGAAACCAGGGGTTGACCCTCTTGG[T/C]AAGMTCTTGTTAAGCTGATAGTCTTTGAGTGAAYGTAGAGAGGGTTTAKT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9d0ekm1