nr2c2

Ensembl ID:
ENSDARG00000042477
ZFIN ID:
ZDB-GENE-080403-8
Description:
nuclear receptor subfamily 2 group C member 2 [Source:RefSeq peptide;Acc:NP_001116766]
Human Orthologue:
NR2C2
Human Description:
nuclear receptor subfamily 2, group C, member 2 [Source:HGNC Symbol;Acc:7972]
Mouse Orthologue:
Nr2c2
Mouse Description:
nuclear receptor subfamily 2, group C, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352466]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34524 Nonsense Mutation detected in F1 DNA During 2017
sa12029 Essential Splice Site Available for shipment Available now
sa14160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011597 Nonsense 105 623 3 14
ENSDART00000125232 Nonsense 105 623 4 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55380201)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53247602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCGGGTAAAGTCCTGCTGGCGTCCCCAGAGAGCTCCAGCGCCAAA[C/T]AGCTCATCTTCGCCACTGCCGACAGCCTGGTACCCGGCAGAATACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011597 Essential Splice Site 215 623 5 14
ENSDART00000125232 Essential Splice Site 215 623 6 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55378459)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53249344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTTCTGCCGGCTCCGCAAGTGCCTGGAGATGGGCATGAAGATGGAGT[G/A]TGAGTGACGCAGAAACAGCAGGGCTGGGGGGCGATGAATSCAATCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011597 Nonsense 545 623 13 14
ENSDART00000125232 Nonsense 545 623 14 15
Genomic Location (Zv9):
Chromosome 8 (position 55368164)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53259639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCWCCAGATCATCCAGGTTTGAGTAGCTGCAGCCAGATTGAAAAGTTT[C/T]AGGAGAAAGCGCAGATGGAGCTCCAGGACTATGTGCAGAAGACCTATCCR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link