tlk1a

Ensembl ID:
ENSDARG00000042467
ZFIN ID:
ZDB-GENE-071008-2
Description:
Tousled-like kinase 1 [Source:UniProtKB/TrEMBL;Acc:B8A5H2]
Human Orthologue:
TLK1
Human Description:
tousled-like kinase 1 [Source:HGNC Symbol;Acc:11841]
Mouse Orthologue:
Tlk1
Mouse Description:
tousled-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2441683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16145 Nonsense Available for shipment Available now
sa5519 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062265 Nonsense 232 730 10 22
ENSDART00000102892 Nonsense 219 332 10 12
ENSDART00000123074 Nonsense 232 730 11 23
ENSDART00000130861 Nonsense 219 333 10 12
ENSDART00000147650 None None 131 None 7
Genomic Location:
Chromosome 9 (position 3586449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTGTTCTCCRCAGGCAAACTGTGATCTTAGGAGACAAATTGACGAA[C/T]AACARAAGCTTCTAGAAAAATACAAGGAACGTTTAAACAAGTGCATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062265 Nonsense 432 730 15 22
ENSDART00000102892 None None 332 None 12
ENSDART00000123074 Nonsense 432 730 16 23
ENSDART00000130861 None None 333 None 12
ENSDART00000147650 None None 131 None 7
Genomic Location:
Chromosome 9 (position 3595272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCTAAAATGTCAGATTCAAGGACCATCCCACCCTGAATGAAYGCTA[T/A]CTGCTGTTACATCTGCTGGGCAGGGGTGGATTCAGTGAAGTCTACAAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hvef3mih