rfc4

Ensembl ID:
ENSDARG00000042458
ZFIN IDs:
ZDB-GENE-040824-3, ZDB-GENE-040824-3
Description:
replication factor C subunit 4 [Source:RefSeq peptide;Acc:NP_999902]
Human Orthologue:
RFC4
Human Description:
replication factor C (activator 1) 4, 37kDa [Source:HGNC Symbol;Acc:9972]
Mouse Orthologue:
Rfc4
Mouse Description:
replication factor C (activator 1) 4 Gene [Source:MGI Symbol;Acc:MGI:2146571]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35172 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062250 Essential Splice Site 92 220 3 6
ENSDART00000075612 Essential Splice Site 92 202 3 7
Genomic Location (Zv9):
Chromosome 11 (position 46550358)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 45054597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAGGAAAGACGTCCACCATCCTCGCTGCAGCCAGAGAGCTTTATGGG[T/A]AATGTAGTGCTGATCACACTAATTCACATTTTTGTGACTCGACTGTGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link