p2rx4b

Ensembl ID:
ENSDARG00000042452
ZFIN ID:
ZDB-GENE-030319-4
Description:
purinergic receptor P2X, ligand-gated ion channel, 4b [Source:RefSeq peptide;Acc:NP_001119914]
Human Orthologue:
P2RX4
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 4 [Source:HGNC Symbol;Acc:8535]
Mouse Orthologue:
P2rx4
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel 4 Gene [Source:MGI Symbol;Acc:MGI:1338859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21328 Essential Splice Site Available for shipment Available now
sa2440 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa21328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098969 Essential Splice Site 149 401 6 13
ENSDART00000098975 Essential Splice Site 142 394 5 12
Genomic Location (Zv9):
Chromosome 8 (position 31600032)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30742758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAATGTAAAATGGTCATCAACATCCTTCTTGATGTGTGATCCACACA[G/A]GCGTTCAGACGGGCAAATGTGTCCAATACTCTGAAACCATCAAAACCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2440
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098969 Nonsense 201 401 7 13
ENSDART00000098975 Nonsense 194 394 6 12
Genomic Location (Zv9):
Chromosome 8 (position 31600267)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30742993
KASP Assay ID:
554-3003.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCGCAGCGGARGATTTCACCGTGCTCATCAAAAACAACATTCAGTA[T/A]CCAAAGTTCAAATTCAGAAAGTAAGTACACTAATTAGTAGTTCAGGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link