ankrd13c

Ensembl ID:
ENSDARG00000042444
ZFIN IDs:
ZDB-GENE-030131-3892, ZDB-GENE-030131-3892
Description:
Ankyrin repeat domain-containing protein 13C [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUV0]
Human Orthologue:
ANKRD13C
Human Description:
ankyrin repeat domain 13C [Source:HGNC Symbol;Acc:25374]
Mouse Orthologue:
Ankrd13c
Mouse Description:
ankyrin repeat domain 13c Gene [Source:MGI Symbol;Acc:MGI:2139746]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4442 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa6224 Nonsense Mutation detected in F1 DNA During 2014
sa21986 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062237 Missense 20 488 1 13
ENSDART00000121622 Essential Splice Site None 179 1 6
Genomic Location:
Chromosome 11 (position 46225332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAAGATCCGCTCGGTGCGCAAAGAGCGCAAGTCGGGTTTGGATCTGC[T/A]GGAGCCGGACGAGGAGCCCGCGGCCACCGGGCCCGCCAAACACCGGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062237 Nonsense 173 488 5 13
ENSDART00000121622 None None 179 None 6
Genomic Location:
Chromosome 11 (position 46215738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCAGTGATGTTCTGTGTTTCTCTCTTCNNNAGCTTGGAGATTTCTA[T/A]CTRGAGCTGCACTGGGACTTCCAGAGCTGGGGTGAGGCMAGYGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062237 Nonsense 349 488 9 13
ENSDART00000121622 Nonsense 40 179 2 6
Genomic Location:
Chromosome 11 (position 46214611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACAAGGCCATCATGGAGAGCTTCAGCAAAGGAGGAAGCCTCATCGAG[C/T]AGAACTTCGAGGTGAGCGCCGCTTCCCTACATCCAGATATGTGAAGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zqtusq8b