p2rx7

Ensembl ID:
ENSDARG00000042440
ZFIN ID:
ZDB-GENE-030319-6
Description:
P2X purinoceptor 7 [Source:RefSeq peptide;Acc:NP_945335]
Human Orthologue:
P2RX7
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 7 [Source:HGNC Symbol;Acc:8537]
Mouse Orthologue:
P2rx7
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 7 Gene [Source:MGI Symbol;Acc:MGI:1339957]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17772 Essential Splice Site Available for shipment Available now
sa21329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062229 Essential Splice Site 40 596 1 14
ENSDART00000122741 Essential Splice Site None 302 1 16
Genomic Location (Zv9):
Chromosome 8 (position 31627005)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30769731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCTCACTGAAMTGGACGTTAAACGGAGTGATCTTGATGTTYATTTG[G/A]TAAGTGTTTCTCCAWATGTCGCCCCCRCWTCGTCCAACAAGAGCTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062229 Nonsense 194 596 7 14
ENSDART00000122741 Nonsense 159 302 9 16
Genomic Location (Zv9):
Chromosome 8 (position 31617600)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30760326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTCACTGTGATGATCAAGAATAACATCAGATTTCCAGCATTTAACTA[C/A]ATAAGGTATTTTACTTTTAACACAGAAAACGTTATTTTAATTACTCTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link