LOC567794

Ensembl ID:
ENSDARG00000042418
Human Orthologue:
WBSCR17
Human Description:
Williams-Beuren syndrome chromosome region 17 [Source:HGNC Symbol;Acc:16347]
Mouse Orthologue:
Wbscr17
Mouse Description:
Williams-Beuren syndrome chromosome region 17 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:213759

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22607 Nonsense Available for shipment Available now
sa42513 Nonsense Mutation detected in F1 DNA During 2016
sa35841 Nonsense Mutation detected in F1 DNA During 2016
sa35842 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062191 Nonsense 303 617 6 12
Genomic Location (Zv9):
Chromosome 15 (position 15554106)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16599069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCTCCATAGATAACATCAAAGATGAGACGTTTGAACTGGAACGCTA[T/G]GAGAACTCAGGCCACGGCTATAACTGGGAGCTCTGGTGTATGTATATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062191 Nonsense 351 617 7 12
Genomic Location (Zv9):
Chromosome 15 (position 15557484)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16602447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGGACGCCTGCAATGATAGGCTGCTCTTTTGTGGTAAACCGGGAATA[C/A]TTTGGGGATTTGGGCCTACTGGACGCAGGGATGGATGTGTATGGAGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062191 Nonsense 377 617 8 12
Genomic Location (Zv9):
Chromosome 15 (position 15557725)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16602688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCAGAACTGATTTTTTTTACTGGCATATGTTTTGAAACCCAGGTTTG[G/A]TTGTGTGGGGGCAGCATGGAAGTCCTGCCTTGTTCCAGAGTGGCTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062191 Nonsense 415 617 8 12
Genomic Location (Zv9):
Chromosome 15 (position 15557837)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16602800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCCCTACCACAGTAACATTGCCTTTCACACAAGACGCAATGCTCTT[C/T]GAGTTGCGGAAGTGTGGATGGACCAGTACAAATCTAATGTCTATTTGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link