LOC567794

Ensembl ID:
ENSDARG00000042418
Human Orthologue:
WBSCR17
Human Description:
Williams-Beuren syndrome chromosome region 17 [Source:HGNC Symbol;Acc:16347]
Mouse Orthologue:
Wbscr17
Mouse Description:
Williams-Beuren syndrome chromosome region 17 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:213759

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22607 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062191 Nonsense 303 617 6 12
Genomic Location:
Chromosome 15 (position 15554106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCTCCATAGATAACATCAAAGATGAGACGTTTGAACTGGAACGCTA[T/G]GAGAACTCAGGCCACGGCTATAACTGGGAGCTCTGGTGTATGTATATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1cx2n39w