rab40b

Ensembl ID:
ENSDARG00000042410
ZFIN ID:
ZDB-GENE-040718-257
Description:
ras-related protein Rab-40B [Source:RefSeq peptide;Acc:NP_001002524]
Human Orthologues:
RAB40A, RAB40AL, RAB40B
Human Descriptions:
RAB40A, member RAS oncogene family [Source:HGNC Symbol;Acc:18283]
RAB40A, member RAS oncogene family-like [Source:HGNC Symbol;Acc:25410]
RAB40B, member RAS oncogene family [Source:HGNC Symbol;Acc:18284]
Mouse Orthologue:
Rab40b
Mouse Description:
Rab40b, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:2183451]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12834 Nonsense Available for shipment Available now
sa24917 Nonsense Mutation detected in F1 DNA During 2016
sa42066 Nonsense Mutation detected in F1 DNA During 2016
sa9095 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 51 279 2 6
ENSDART00000140685 Nonsense 51 203 3 7
Genomic Location (Zv9):
Chromosome 12 (position 33738583)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31936580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAGCATTTAAGTMATTTTATTTCATTTTAAATTGCAGGAATYGACTA[C/A]AAGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTKTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 52 279 2 6
ENSDART00000140685 Nonsense 52 203 3 7
Genomic Location (Zv9):
Chromosome 12 (position 33738582)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31936579
KASP Assay ID:
554-7613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCATTTAAGTCATTTTATTTCATTTTAAATTGCAGGAATCGACTAC[A/T]AGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 73 279 3 6
ENSDART00000140685 Nonsense 73 203 4 7
Genomic Location (Zv9):
Chromosome 12 (position 33735771)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31933768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCAATGTCTTCTTTGTTGTTTTTGTTTTGTAAAGGGACACCTCAGGA[C/T]AAGGCAGATTCTGTACCATATTCCGCTCCTATTCCAGAGGAGCACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 108 279 4 6
ENSDART00000140685 Nonsense 108 203 5 7
Genomic Location (Zv9):
Chromosome 12 (position 33734131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31932128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTTTATGACATCACWAACCGGTGGTCTTTCGACGGCATCGACAGATG[G/A]ATTAAAGAGATTGATGAGGWAAAATCAGGWCAATCAGATCCAAAATGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link