si:ch211-251j10.3

Ensembl ID:
ENSDARG00000042409
ZFIN ID:
ZDB-GENE-081105-110
Description:
ral guanine nucleotide dissociation stimulator [Source:RefSeq peptide;Acc:NP_001116789]
Human Orthologues:
RALGDS, RGL4
Human Descriptions:
ral guanine nucleotide dissociation stimulator [Source:HGNC Symbol;Acc:9842]
ral guanine nucleotide dissociation stimulator-like 4 [Source:HGNC Symbol;Acc:31911]
Mouse Orthologue:
Ralgds
Mouse Description:
ral guanine nucleotide dissociation stimulator Gene [Source:MGI Symbol;Acc:MGI:107485]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38699 Nonsense Mutation detected in F1 DNA During 2017
sa15004 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062181 Nonsense 112 812 2 17
ENSDART00000138959 Nonsense 137 813 2 16
Genomic Location (Zv9):
Chromosome 8 (position 31811977)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30954703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGCTGGCACACTGGAGAAACTAGTGGAGTACATGGTCTCCGCCTTC[A/T]AAGGGAAAGACTACACTTACGTCACTATTTTCCTCTGCACCTACAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062181 Essential Splice Site 754 812 16 17
ENSDART00000138959 Essential Splice Site 755 813 15 16
Genomic Location (Zv9):
Chromosome 8 (position 31799367)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30942093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAAATCTGAAGACTATGAATTGTTACAGAGGGTCWCAAAGCATAAAG[G/A]TAAGGAACTGAAACAGGAAATATTGAAGGGCTTGGTTTTTYATTAGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link