kif26aa

Ensembl ID:
ENSDARG00000042368
ZFIN ID:
ZDB-GENE-041001-148
Description:
Novel protein similar to vertebrate kinesin family member 26 [Source:UniProtKB/TrEMBL;Acc:Q5RIG4]
Human Orthologue:
KIF26A
Human Description:
kinesin family member 26A [Source:HGNC Symbol;Acc:20226]
Mouse Orthologue:
Kif26a
Mouse Description:
kinesin family member 26A Gene [Source:MGI Symbol;Acc:MGI:2447072]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16496 Nonsense Available for shipment Available now
sa4346 Nonsense Mutation detected in F1 DNA During 2014
sa11439 Nonsense Available for shipment Available now
sa9495 Essential Splice Site Available for shipment Available now
sa16695 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002641 Nonsense 318 1906 5 15
ENSDART00000136251 Nonsense 11 1599 1 11
Genomic Location:
Chromosome 20 (position 27549065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGCCACTGTTATGCAGGGCTGCCCAGAAGCTGAACCTCTCCAAACGG[A/T]AGAAGCCTCAGCCACTTCCGCCATCTCCTCCGGACCCAGAAGAGCCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002641 Nonsense 376 1906 6 15
ENSDART00000136251 Nonsense 69 1599 2 11
Genomic Location:
Chromosome 20 (position 27558259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTATGATATGAATGTAATTTTGTGCCTTGCAGGTGAAAGWGATGGTG[C/T]GACTATGTAATGCCAAAGGATCGAGAGACACCTCAGAATCCATGTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002641 Nonsense 638 1906 10 15
ENSDART00000136251 Nonsense 331 1599 6 11
Genomic Location:
Chromosome 20 (position 27567344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGCATCTTCTGGACTTAGGAAGTTGTGAGTCTGATCTGAGTCAAACC[C/T]GAGATGGAGGAARAGGCCAGTGTTTGTCAYTAGGTGCCCTTGGAAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002641 Essential Splice Site 668 1906 11 15
ENSDART00000136251 Essential Splice Site 361 1599 7 11
Genomic Location:
Chromosome 20 (position 27567991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCTGGCTTCCTTTTTGGCTAACGAGGAGATTTTTTGATGTATAATTC[A/T]GAGACAGCAAGCTTACCATGCTGCTGAGGGAATCGCTGGGCAACATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002641 Splice Site, Nonsense 723 1906 12 15
ENSDART00000136251 Splice Site, Nonsense 416 1599 8 11
Genomic Location:
Chromosome 20 (position 27568996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGCACAGATATATTTATGTSAGTGTTGTGTGTTATTCTSTTCAGTA[T/A]GCATCAAGTTCCTCTGGAGGGGAGAGCTCCTGTGAAGAGRGACACATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ldoau0w7