cldnk

Ensembl ID:
ENSDARG00000042357
ZFIN ID:
ZDB-GENE-040801-201
Description:
claudin k [Source:RefSeq peptide;Acc:NP_001003464]
Human Orthologues:
CLDN17, CLDN8
Human Descriptions:
claudin 17 [Source:HGNC Symbol;Acc:2038]
claudin 8 [Source:HGNC Symbol;Acc:2050]
Mouse Orthologues:
Cldn17, Cldn8
Mouse Descriptions:
claudin 17 Gene [Source:MGI Symbol;Acc:MGI:2652030]
claudin 8 Gene [Source:MGI Symbol;Acc:MGI:1859286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa98 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa98
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062116 Nonsense 166 216 2 2
Genomic Location:
Chromosome 3 (position 47641599)
KASP Assay ID:
554-0135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTATGTGGCGGCCCCACACAAACGTGAGCTTGGACCCGCTCTCTACT[T/A]GGGCTGGGGGGCTTCGGCTTTACTGTTGATTGGTGGATCGCTTCTCTATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/du80phr7