trmt6

Ensembl ID:
ENSDARG00000042344
ZFIN ID:
ZDB-GENE-051120-141
Description:
fermitin family homolog 1 [Source:RefSeq peptide;Acc:NP_001032469]
Human Orthologue:
TRMT6
Human Description:
tRNA methyltransferase 6 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20900]
Mouse Orthologue:
Trmt6
Mouse Description:
tRNA methyltransferase 6 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914176]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19244 Nonsense Mutation detected in F1 DNA During 2014
sa11287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062092 Nonsense 19 464 1 11
ENSDART00000062092 Nonsense 19 464 1 11
Genomic Location:
Chromosome 20 (position 45974639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGTGTGAATGACAGCGATGAAGACAGCAGAATCGCATACGGAGACTA[T/G]GTAGTGCTGAAGAGAGGAGAAGTCTTTAAATCTGTCCAGGTGGAGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062092 Nonsense 19 464 1 11
ENSDART00000062092 Nonsense 19 464 1 11
Genomic Location:
Chromosome 20 (position 45974639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTGTGAATGACAGCGATGAAGAMAGCAGAATCGCATACGGAGACTA[T/G]GTAGTGCTGAAGAGAGGAGAAGTCTTYAAATCTGTCCWGGTGGAGAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nle4j36s