impdh1a

Ensembl ID:
ENSDARG00000042336
ZFIN ID:
ZDB-GENE-040704-15
Description:
inosine 5'-phosphate dehydrogenase 1a [Source:RefSeq peptide;Acc:NP_001002177]
Human Orthologue:
IMPDH1
Human Description:
IMP (inosine 5'-monophosphate) dehydrogenase 1 [Source:HGNC Symbol;Acc:6052]
Mouse Orthologue:
Impdh1
Mouse Description:
inosine 5'-phosphate dehydrogenase 1 Gene [Source:MGI Symbol;Acc:MGI:96567]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16224 Essential Splice Site Available for shipment Available now
sa23234 Essential Splice Site Available for shipment Available now
sa15860 Nonsense Available for shipment Available now
sa9932 Nonsense Available for shipment Available now
sa43048 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017619 Essential Splice Site None 544 1 16
ENSDART00000101161   None 624 None 16
ENSDART00000137098   None 87 None 4
ENSDART00000143519   None 179 None 5
Genomic Location (Zv9):
Chromosome 18 (position 8277407)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8854785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTCAKCMGAAGGAAGTGTGTTCCGAAAGAGAAAGTAACTCGAGACTG[T/G]AAGTGGATTTATTTGTTTTTTCGACCTAASACGCTTTTAAAAYGAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017619 Essential Splice Site 83 544 4 16
ENSDART00000101161 Essential Splice Site 163 624 4 16
ENSDART00000137098   None 87 None 4
ENSDART00000143519   None 179 None 5
Genomic Location (Zv9):
Chromosome 18 (position 8289935)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8867313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCCAATGGACACAGTCACAGAGTCCTCAATGGCCATTGCTATGGCT[G/T]TAAGTAACATTTACAAACACATATATAAAGTGTAAATTTTCCATTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017619 Nonsense 161 544 6 16
ENSDART00000101161 Nonsense 241 624 6 16
ENSDART00000137098   None 87 None 4
ENSDART00000143519   None 179 None 5
Genomic Location (Zv9):
Chromosome 18 (position 8290383)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8867761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGAAACTGGAAAGWTGGGCAGCAAGCTGGTGGGCATTGTTACGTCA[C/T]GAGACATCGACTTCCTGTCAGAAAAAGACTATGATAGGCCACTGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017619 Nonsense 233 544 8 16
ENSDART00000101161 Nonsense 313 624 8 16
ENSDART00000137098   None 87 None 4
ENSDART00000143519   None 179 None 5
Genomic Location (Zv9):
Chromosome 18 (position 8291926)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8869304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTTGTTGCAATAAKCGCTCGTACCGATTTGAAGAAGAACMGAGATTA[T/A]CCTCTGGCCTCCAAAGACTCCCGCAAACAGCTCCTGTGCGGCGCCGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017619 Essential Splice Site 514 544 16 16
ENSDART00000101161 Essential Splice Site 594 624 16 16
ENSDART00000137098   None 87 None 4
ENSDART00000143519 Essential Splice Site 173 179 5 5
Genomic Location (Zv9):
Chromosome 18 (position 8306525)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8883903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTAGAGAAAAAAGGCTCATGTTTAATGCTCTGTTTGTCTTCCGGCA[G/A]TTACGAGAAACGGTTATATTGAGCCTGGCAGCAGAGGGCACCCAAGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link