plin2

Ensembl ID:
ENSDARG00000042332
ZFIN ID:
ZDB-GENE-050913-12
Description:
perilipin-2 [Source:RefSeq peptide;Acc:NP_001025433]
Human Orthologue:
PLIN2
Human Description:
perilipin 2 [Source:HGNC Symbol;Acc:248]
Mouse Orthologue:
Plin2
Mouse Description:
perilipin 2 Gene [Source:MGI Symbol;Acc:MGI:87920]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35844 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062069   None 326 None 4
ENSDART00000129407 Nonsense 7 444 1 8
Genomic Location (Zv9):
Chromosome 15 (position 16049978)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17094941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCATTACAGCAACTGAGAAGCACTTCATGAGCTTTCTTCTGTACT[T/A]GAAACTGCACAACAGGTAAAAAAGCGTTTTTGTTCGGTTTCTATCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link