si:dkey-177p2.6

Ensembl ID:
ENSDARG00000042322
ZFIN ID:
ZDB-GENE-030131-5926
Description:
hypothetical protein LOC568712 [Source:RefSeq peptide;Acc:NP_001068584]
Human Orthologues:
CDCA4, SERTAD2
Human Descriptions:
cell division cycle associated 4 [Source:HGNC Symbol;Acc:14625]
SERTA domain containing 2 [Source:HGNC Symbol;Acc:30784]
Mouse Orthologues:
Cdca4, Sertad2
Mouse Descriptions:
cell division cycle associated 4 Gene [Source:MGI Symbol;Acc:MGI:1919213]
SERTA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1931026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5952 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062066 Nonsense 92 285 2 2
ENSDART00000140418 Nonsense 92 229 2 2
Genomic Location (Zv9):
Chromosome 20 (position 26988370)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27059673
KASP Assay ID:
554-3759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGAGGCAGCTGGTGCTGGACYTGTGTCTAGACAAACTACAAAGCTG[C/A]CAGCGGCGAGCGGAACCCAGCCTGCACCGTTCGGTCCTCCTGGCCAAYAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link