dlx5a

Ensembl ID:
ENSDARG00000042296
ZFIN IDs:
ZDB-GENE-990415-49, ZDB-GENE-990415-49
Description:
Homeobox protein Dlx5a [Source:UniProtKB/Swiss-Prot;Acc:P50576]
Human Orthologue:
DLX5
Human Description:
distal-less homeobox 5 [Source:HGNC Symbol;Acc:2918]
Mouse Orthologue:
Dlx5
Mouse Description:
distal-less homeobox 5 Gene [Source:MGI Symbol;Acc:MGI:101926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13174 Nonsense Available for shipment Available now
sa39257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062026 Nonsense 72 281 1 5
ENSDART00000113388 Nonsense 72 282 1 3
Genomic Location (Zv9):
Chromosome 19 (position 42443772)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41886786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTRTTGTTCACCGAACTCGGGCWCCTATGGGAAACCTCTTAATGCCTA[T/G]CAGTACCAATACCACGGAGTCAATGGATCTTCTGGAAATTACTCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062026 Nonsense 126 281 2 5
ENSDART00000113388 Nonsense 126 282 2 3
Genomic Location (Zv9):
Chromosome 19 (position 42443231)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41886245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCATCTAATTTCTGTTTTATTTGCCAGAAAAAGAAACAGCCGAGCCC[G/T]AAGTAAGGATGGTCAACGGAAAACCCAAAAAAGTCCGGAAGCCCCGAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link