ca4b

Ensembl ID:
ENSDARG00000042293
ZFIN ID:
ZDB-GENE-080815-5
Description:
carbonic anhydrase IV b [Source:RefSeq peptide;Acc:NP_001159683]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11285 Essential Splice Site Available for shipment Available now
sa19106 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062024 Essential Splice Site 263 320 8 8
ENSDART00000062024 Essential Splice Site 263 320 8 8
Genomic Location:
Chromosome 15 (position 14420147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTCTTTGGTGTGAATTGCTCTGAATACCATCTTATCTTTGTCTTGC[A/G]GCTTTCTGCATTTTCAAACTTGACGTTTTCAGACGGTGCGGCCATGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062024 Essential Splice Site 263 320 8 8
ENSDART00000062024 Essential Splice Site 263 320 8 8
Genomic Location:
Chromosome 15 (position 14420147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTCTTTGGTGTGAATTGCTCTGAATACCATCTTATCTTTGTCTTGC[A/G]GCTTTCTGCATTTTCAAACTTGACGTTTTCAGACGGTGCGGCCATGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hoa1lzi5