dlx6a

Ensembl ID:
ENSDARG00000042291
ZFIN ID:
ZDB-GENE-980526-448
Description:
Homeobox protein Dlx6a [Source:UniProtKB/Swiss-Prot;Acc:Q98877]
Human Orthologue:
DLX6
Human Description:
distal-less homeobox 6 [Source:HGNC Symbol;Acc:2919]
Mouse Orthologue:
Dlx6
Mouse Description:
distal-less homeobox 6 Gene [Source:MGI Symbol;Acc:MGI:101927]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36900 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102778 Nonsense 31 247 1 3
Genomic Location (Zv9):
Chromosome 19 (position 42437304)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41880318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACTCGTCAAAATCTGCTTTCATGGAGTTTGGACAGCAATCGCACTCA[C/T]AACAGAGCTCCCCGTCGATGGCCGCCAGCCATTATCCGCTCCACTGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link