itga6a

Ensembl ID:
ENSDARG00000042282
ZFIN ID:
ZDB-GENE-050309-23
Description:
integrin alpha-6 [Source:RefSeq peptide;Acc:NP_001138253]
Human Orthologue:
ITGA6
Human Description:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
Mouse Orthologue:
Itga6
Mouse Description:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18258 Essential Splice Site Available for shipment Available now
sa8328 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21422 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082153 Essential Splice Site 333 1071 6 25
ENSDART00000114168 Essential Splice Site 333 1092 6 25
Genomic Location:
Chromosome 9 (position 3453234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCTTCATTTGGAWATGATGTAGCTGTGGTGGACCTCAATGGAGACGG[G/A]TGAGCCACACAAGATGCYACAAACATCTTAGCAACAWGCTCTAATAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082153 Essential Splice Site 397 1071 7 25
ENSDART00000114168 Essential Splice Site 397 1092 7 25
Genomic Location:
Chromosome 9 (position 3453956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGWCTGTCTGTGGAGAACATTGGAGACGTTAATCTGGATTCATTTGAAG[G/A]TTTGTTGAAGCTGATTTTTTTNTATGATTTGATTAGTTTAGATTGAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082153 Nonsense 518 1071 11 25
ENSDART00000114168 Nonsense 518 1092 11 25
Genomic Location:
Chromosome 9 (position 3460712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGACAGTGGAAGCGTGTTTCTCCTATAGAGCAAACCCCACAACCTA[C/A]AACCCCAAGATCAGTAAGTGCTCTCATCATCTATTAGTTTAATATGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9jluehj3