itga6a

Ensembl ID:
ENSDARG00000042282
ZFIN ID:
ZDB-GENE-050309-23
Description:
integrin alpha-6 [Source:RefSeq peptide;Acc:NP_001138253]
Human Orthologue:
ITGA6
Human Description:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
Mouse Orthologue:
Itga6
Mouse Description:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18258 Essential Splice Site Available for shipment Available now
sa21422 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082153 Essential Splice Site 333 1071 6 25
ENSDART00000114168 Essential Splice Site 333 1092 6 25
Genomic Location (Zv9):
Chromosome 9 (position 3453234)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3485255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCTTCATTTGGAWATGATGTAGCTGTGGTGGACCTCAATGGAGACGG[G/A]TGAGCCACACAAGATGCYACAAACATCTTAGCAACAWGCTCTAATAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082153 Nonsense 518 1071 11 25
ENSDART00000114168 Nonsense 518 1092 11 25
Genomic Location (Zv9):
Chromosome 9 (position 3460712)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3492733
KASP Assay ID:
2260-1408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGACAGTGGAAGCGTGTTTCTCCTATAGAGCAAACCCCACAACCTA[C/A]AACCCCAAGATCAGTAAGTGCTCTCATCATCTATTAGTTTAATATGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link