tmem231

Ensembl ID:
ENSDARG00000042272
ZFIN ID:
ZDB-GENE-040426-1386
Description:
Transmembrane protein 231 [Source:UniProtKB/Swiss-Prot;Acc:Q7T316]
Human Orthologue:
TMEM231
Human Description:
transmembrane protein 231 [Source:HGNC Symbol;Acc:37234]
Mouse Orthologue:
Tmem231
Mouse Description:
transmembrane protein 231 Gene [Source:MGI Symbol;Acc:MGI:2685024]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6811 Nonsense Mutation detected in F1 DNA During 2016
sa4329 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38131 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061996 Nonsense 35 309 1 7
ENSDART00000145416 Nonsense 35 261 1 6
Genomic Location:
Chromosome 25 (position 35909332)
KASP Assay ID:
554-5384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCACGCGAGCTACGCTGTTTGTCTGTGTGGTKTTAKGCCTCACTTA[T/A]ATTTCACCTCTTCTGGTGGCTTACMGAAGTCAAGGTAAGTGCTATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061996 Essential Splice Site 102 309 2 7
ENSDART00000145416 Essential Splice Site 102 261 2 6
Genomic Location:
Chromosome 25 (position 35909609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTTTAATCGACTGATTGGAGACAATTTACGCATCCCTGAAATMTCTG[T/A]RAGTACAAAACTCGTGAGGTCAAGACCCAAATATCTAAAAAAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061996 Nonsense 142 309 3 7
ENSDART00000145416 Nonsense 142 261 3 6
Genomic Location:
Chromosome 25 (position 35911531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCAGCAGAGCAGATGTTCAGCGTTCAGCTCCTCCTCACCTTCTCCTA[C/A]CAGCTGTTTGTGCGTATTCAGTCCAGTTCATTTCCATCTCACCTCACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link