tmem231

Ensembl ID:
ENSDARG00000042272
ZFIN ID:
ZDB-GENE-040426-1386
Description:
Transmembrane protein 231 [Source:UniProtKB/Swiss-Prot;Acc:Q7T316]
Human Orthologue:
TMEM231
Human Description:
transmembrane protein 231 [Source:HGNC Symbol;Acc:37234]
Mouse Orthologue:
Tmem231
Mouse Description:
transmembrane protein 231 Gene [Source:MGI Symbol;Acc:MGI:2685024]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6811 Nonsense Mutation detected in F1 DNA During 2014
sa4329 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061996 Nonsense 35 309 1 7
ENSDART00000145416 Nonsense 35 261 1 6
Genomic Location:
Chromosome 25 (position 35909332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCACGCGAGCTACGCTGTTTGTCTGTGTGGTKTTAKGCCTCACTTA[T/A]ATTTCACCTCTTCTGGTGGCTTACMGAAGTCAAGGTAAGTGCTATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061996 Essential Splice Site 102 309 2 7
ENSDART00000145416 Essential Splice Site 102 261 2 6
Genomic Location:
Chromosome 25 (position 35909609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTTTAATCGACTGATTGGAGACAATTTACGCATCCCTGAAATMTCTG[T/A]RAGTACAAAACTCGTGAGGTCAAGACCCAAATATCTAAAAAAAAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zan1ix1x