arsa

Ensembl ID:
ENSDARG00000042270
ZFIN ID:
ZDB-GENE-050320-118
Description:
arylsulfatase A [Source:RefSeq peptide;Acc:NP_001013561]
Human Orthologue:
ARSA
Human Description:
arylsulfatase A [Source:HGNC Symbol;Acc:713]
Mouse Orthologue:
Arsa
Mouse Description:
arylsulfatase A Gene [Source:MGI Symbol;Acc:MGI:88077]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14243 Nonsense Available for shipment Available now
sa6501 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 108 499 2 8
ENSDART00000140193 Nonsense 112 503 2 8
Genomic Location:
Chromosome 18 (position 7699518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCCGGGCTCAAGAGGCGGTCTCCCTCTCAACGAGACCACCATAGCC[G/T]AGGTGCTGAAGACTCAGGGTTACTCCACAGCAATAGTCGGAAAGTGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 155 499 3 8
ENSDART00000140193 Nonsense 159 503 3 8
Genomic Location:
Chromosome 18 (position 7699910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTKTCWTTGCACAATKTTTAAGGYATGATTTCTCTATTATAGGGTCCCTG[T/A]CAGAATCTGAGCTGCTTCCCTCCGGATGTGAAGTGTTTTGGCCTGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kg534yk7