arsa

Ensembl ID:
ENSDARG00000042270
ZFIN ID:
ZDB-GENE-050320-118
Description:
arylsulfatase A [Source:RefSeq peptide;Acc:NP_001013561]
Human Orthologue:
ARSA
Human Description:
arylsulfatase A [Source:HGNC Symbol;Acc:713]
Mouse Orthologue:
Arsa
Mouse Description:
arylsulfatase A Gene [Source:MGI Symbol;Acc:MGI:88077]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14243 Nonsense Available for shipment Available now
sa6501 Nonsense Mutation detected in F1 DNA During 2016
sa32188 Nonsense Mutation detected in F1 DNA During 2016
sa43044 Nonsense Mutation detected in F1 DNA During 2016
sa43045 Nonsense Mutation detected in F1 DNA During 2016
sa36571 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 108 499 2 8
ENSDART00000140193 Nonsense 112 503 2 8
Genomic Location:
Chromosome 18 (position 7699518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCCGGGCTCAAGAGGCGGTCTCCCTCTCAACGAGACCACCATAGCC[G/T]AGGTGCTGAAGACTCAGGGTTACTCCACAGCAATAGTCGGAAAGTGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 155 499 3 8
ENSDART00000140193 Nonsense 159 503 3 8
Genomic Location:
Chromosome 18 (position 7699910)
KASP Assay ID:
554-4556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTKTCWTTGCACAATKTTTAAGGYATGATTTCTCTATTATAGGGTCCCTG[T/A]CAGAATCTGAGCTGCTTCCCTCCGGATGTGAAGTGTTTTGGCCTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 188 499 3 8
ENSDART00000140193 Nonsense 192 503 3 8
Genomic Location:
Chromosome 18 (position 7700007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCAGGGTGTTGTGACTGTACCTCTCCTGTTTAATGAGATTATCAAG[C/T]AGCAGCCTGCAGATTTCCTCCAGCTGGAGAAAGCCTATGGTGAATTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 206 499 3 8
ENSDART00000140193 Nonsense 210 503 3 8
Genomic Location:
Chromosome 18 (position 7700061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTGCAGATTTCCTCCAGCTGGAGAAAGCCTATGGTGAATTCGCCTCT[C/T]AGTTCATCAGTGACTCTGTCAAGGACAATCGCCCATTCTTCTTGTACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 222 499 3 8
ENSDART00000140193 Nonsense 226 503 3 8
Genomic Location:
Chromosome 18 (position 7700111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCATCAGTGACTCTGTCAAGGACAATCGCCCATTCTTCTTGTACTA[T/A]CCTTCACATGTGAGTCAAGAACAGTTACCTTTATCAGAATACATCTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061989 Nonsense 262 499 4 8
ENSDART00000140193 Nonsense 266 503 4 8
Genomic Location:
Chromosome 18 (position 7702525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCGGTGATGCTCTGATGGAGTTTGATGGCACTGTAGGGAAGATTCTG[C/T]AGACTCTGGAAGAAACGGGTGTCATCAACAACACTCTCATCTTCTTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link