ddx41

Ensembl ID:
ENSDARG00000042269
ZFIN ID:
ZDB-GENE-030131-1927
Description:
probable ATP-dependent RNA helicase DDX41 [Source:RefSeq peptide;Acc:NP_957339]
Human Orthologue:
DDX41
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 [Source:HGNC Symbol;Acc:18674]
Mouse Orthologue:
Ddx41
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 Gene [Source:MGI Symbol;Acc:MGI:1920185]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14887 Nonsense Available for shipment Available now
sa6359 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa14887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061987 Nonsense 274 473 8 13
ENSDART00000130634   None 171 None 5
Genomic Location (Zv9):
Chromosome 14 (position 52010029)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150642.1 48020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTTTTAGGAAGTGGAGTACGTGAAAGAAGAGGCCAAGATGGTTTA[T/A]CTGCTGGAGTGTCTTCAGAAAACCCCACCGCCGGTAYGCAGACGCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6359
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061987 Nonsense 358 473 10 13
ENSDART00000130634   None 171 None 5
Genomic Location (Zv9):
Chromosome 14 (position 52006398)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150642.1 44389
KASP Assay ID:
554-5123.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCTTCCAAGGGTCWGGATTTCCCAGCTATACAGCATGTAGTCAATTA[T/G]GACATGCCGGAGGAGATCRAGAACTACGGTAGGTGTTTTTCTTAGTGCTA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
brain
ZFA:0000008
necrotic
PATO:0000647
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link