eif4h

Ensembl ID:
ENSDARG00000042252
ZFIN ID:
ZDB-GENE-010328-19
Description:
eukaryotic translation initiation factor 4H isoform 1 [Source:RefSeq peptide;Acc:NP_001184257]
Human Orthologue:
EIF4H
Human Description:
eukaryotic translation initiation factor 4H [Source:HGNC Symbol;Acc:12741]
Mouse Orthologue:
Eif4h
Mouse Description:
eukaryotic translation initiation factor 4H Gene [Source:MGI Symbol;Acc:MGI:1341822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19101 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061963 Essential Splice Site 168 262 5 8
ENSDART00000108626 Essential Splice Site 168 262 5 8
ENSDART00000132227 Essential Splice Site 31 125 1 4
ENSDART00000144949 None None 119 None 4
Genomic Location:
Chromosome 15 (position 4455332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGAGAAGACTTCGACCAGTCTGGAGGAGGTGCGGCGGGTGAAATGGG[C/G]AAGAACTCCAACCCTCGGGGGTTTTAGTACTTAATAATTGGCTCTACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7kwbaanb