si:ch211-220f12.1

Ensembl ID:
ENSDARG00000042249
ZFIN ID:
ZDB-GENE-050419-154
Description:
FERM domain-containing protein 4A [Source:RefSeq peptide;Acc:NP_001122007]
Human Orthologue:
FRMD4A
Human Description:
FERM domain containing 4A [Source:HGNC Symbol;Acc:25491]
Mouse Orthologue:
Frmd4a
Mouse Description:
FERM domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:1919850]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7451 Missense Mutation detected in F1 DNA During 2017
sa36573 Nonsense Mutation detected in F1 DNA During 2017
sa666 Essential Splice Site F2 line generated During 2017
sa43047 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093131 Missense 122 1035 5 24
ENSDART00000147284 Missense 91 1003 4 22
Genomic Location (Zv9):
Chromosome 18 (position 8017443)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8594821
KASP Assay ID:
554-4037.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGTTGATGTATACGTTTCCTCTTTTGCAGGTTCTACATTGAAAGCA[T/A]CTCTTACCTTAAGGATAATGCCACAAKCGAGCTGTTCTTCCTCAATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093131 Nonsense 253 1035 11 24
ENSDART00000147284 Nonsense 222 1003 10 22
Genomic Location (Zv9):
Chromosome 18 (position 8005242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8582620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCAGGATAAGCAGGGTATCCCATGGTGGCTGGGCTTGAGTTA[T/G]AAAGGCATTTTTCAATATGACTACCAGGACAAAGTCAAACCAAGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa666
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093131 Essential Splice Site 295 1035 12 24
ENSDART00000147284 Essential Splice Site 264 1003 11 22
Genomic Location (Zv9):
Chromosome 18 (position 7995047)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8572425
KASP Assay ID:
554-0574.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACTTCAGGGAGAAGAAGTTCTCAGTGGAAGTCCATGACCCGAGAAGG[T/C]AAATCTACATTACAGTCTGCACATRCTTGCTCACACACACAAACTGGCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093131 Nonsense 468 1035 16 24
ENSDART00000147284 Nonsense 436 1003 15 22
Genomic Location (Zv9):
Chromosome 18 (position 7979206)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8556584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCCCACCGTCAGACGCAAAATTGGCACAGCCTTCAAACTGGACGAA[C/T]AGAAAATCCTGCCCAAAGGAGAGGTCAGTGACATCCAACCTCATCCATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link