ppial

Ensembl ID:
ENSDARG00000042247
ZFIN ID:
ZDB-GENE-030131-7459
Description:
peptidylprolyl isomerase A, like [Source:RefSeq peptide;Acc:NP_956251]
Human Orthologues:
AC011483.1, AC013283.2, AC113554.1, PPIA, PPIAL4A, PPIAL4B, PPIAL4C, PPIAL4G, PPIF
Human Descriptions:
peptidylprolyl isomerase A (cyclophilin A) [Source:HGNC Symbol;Acc:9253]
peptidylprolyl isomerase A (cyclophilin A)-like 4A [Source:HGNC Symbol;Acc:24369]
peptidylprolyl isomerase A (cyclophilin A)-like 4B [Source:HGNC Symbol;Acc:33994]
peptidylprolyl isomerase A (cyclophilin A)-like 4C [Source:HGNC Symbol;Acc:33995]
peptidylprolyl isomerase A (cyclophilin A)-like 4G [Source:HGNC Symbol;Acc:33996]
peptidylprolyl isomerase F [Source:HGNC Symbol;Acc:9259]
Mouse Orthologues:
Gm10123, Gm5160, Gm9234, Ppia, Ppif
Mouse Descriptions:
peptidylprolyl isomerase A Gene [Source:MGI Symbol;Acc:MGI:97749]
peptidylprolyl isomerase F (cyclophilin F) Gene [Source:MGI Symbol;Acc:MGI:2145814]
predicted gene 5160 Pseudogene [Source:MGI Symbol;Acc:MGI:3648528]
predicted pseudogene 10123 Pseudogene [Source:MGI Symbol;Acc:MGI:3704342]
predicted pseudogene 9234 Pseudogene [Source:MGI Symbol;Acc:MGI:3648545]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8587 Nonsense Mutation detected in F1 DNA During 2017
sa41740 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061958 Nonsense 93 164 4 5
Genomic Location (Zv9):
Chromosome 10 (position 46006575)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45504501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCATCTACGGCAACAAGTTTGAGGATGAAAACTTCACACTGAAACAC[G/T]GAGGCAAAGGCAYCCTGTCTATGGCCAACGCCGGCCCCAACACCAACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061958 Essential Splice Site 121 164 4 5
Genomic Location (Zv9):
Chromosome 10 (position 46006489)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45504587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAACACCAACGGCTCGCAGTTCTTCATCTGCACCGCCGACACCAACTG[G/A]TAAAACACACACACACACACACACACACACACACACACTATAGAAGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link