atrx

Ensembl ID:
ENSDARG00000042236
ZFIN ID:
ZDB-GENE-030912-11
Description:
Atrxl protein [Source:UniProtKB/TrEMBL;Acc:Q7ZUS5]
Human Orthologue:
ATRX
Human Description:
alpha thalassemia/mental retardation syndrome X-linked [Source:HGNC Symbol;Acc:886]
Mouse Orthologue:
Atrx
Mouse Description:
alpha thalassemia/mental retardation syndrome X-linked homolog (human) Gene [Source:MGI Symbol;Acc:M

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13757 Nonsense Available for shipment Available now
sa10556 Splice Site, Nonsense Available for shipment Available now
sa35643 Nonsense Mutation detected in F1 DNA During 2016
sa35644 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42353 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42354 Nonsense Mutation detected in F1 DNA During 2016
sa35645 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15167 Nonsense Available for shipment Available now
sa17647 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 Nonsense 361 995 9 14
ENSDART00000125865 Nonsense 251 1620 3 34
ENSDART00000127594 Nonsense 361 2011 9 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10871274)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10366631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAGGCCCATGCTGCTCTGGAGGAATCGCTTGAAAATGAATTYGAAT[C/A]RAAAGGCCTCAAGTTTCAGAACGGAGAGGAGCAACGACCATCAAAMWGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 Nonsense 417 995 9 14
ENSDART00000125865 Splice Site, Nonsense 307 1620 3 34
ENSDART00000127594 Nonsense 417 2011 9 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10871441)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10366798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATTGCTCCACCAAGAACCATAAWCCTGTGGGAGAAGAGGAAACCCAG[C/T]AGGACAGTAACTTGGCTGATGTTGAGATGGAAAGCCCTCCACACTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 Nonsense 625 995 9 14
ENSDART00000125865   None 1620 None 34
ENSDART00000127594 Nonsense 625 2011 9 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10872065)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10367422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAAAGAGCAGTGACGCTGTCAAGGAACAGAGTGATTCAGACTCTGAT[G/T]AAGTCCCAGAAGTTCTGCAGAGTGCTGCTTTGAAGGACAGCTCCGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Essential Splice Site 549 1620 7 34
ENSDART00000127594   None 2011 None 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10873979)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10369336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTGAAATGGCTGTGGCAATTAAAAACTAAGACTATAGATAATAGCAA[T/C]AGAAAAGAGCAACTTCTCATTTTCAGTCAGTTATAGTACATGTTGTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Essential Splice Site 1137 1620 23 34
ENSDART00000127594 Essential Splice Site 1483 2011 24 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10906415)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10401772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGAGTCATCTATGAGTTTGACCTCTGAAGATGAGAAGCCCAAAAG[G/A]TTTGAGATGAGTCCTCCTTCTTTCCTGGGAAATGTCCTGTATGGTACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Nonsense 1278 1620 26 34
ENSDART00000127594 Nonsense 1612 2011 27 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10908255)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10403612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGAGTTAGCAGGCAGGGCCAAAGAGGAGGGGAAAGAATCACCATA[C/A]AAAGGTAAGGCATGCTGTTGTATTTAAATAACTATAGAAATTAGCAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Essential Splice Site 1375 1620 28 34
ENSDART00000127594 Essential Splice Site 1709 2011 29 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10911031)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10406388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTTTGGTCAAGTGAAGACTGTATATGTCTACAGGTTTTTGGCTCAGG[T/C]GAGAATTTGTGATGATTGGATAGAGGTTTTCATTGCTATAGTTCAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Nonsense 1500 1620 31 34
ENSDART00000127594 Nonsense 1834 2011 32 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10929421)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10424778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGCTGTTCTTTTAGGGGCTGTCCATGCGTTTCAACCAGCCGTCTTA[T/G]TCTCAGATGGGTATGGGAGCACCAAACTCCTACTTCCCCTTCAACGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932   None 995 None 14
ENSDART00000125865 Essential Splice Site 1603 1620 33 34
ENSDART00000127594 Essential Splice Site 1937 2011 34 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10933146)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10428503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACACAGGGAGGCCATTTATCGTGATGTCCTCAGCAAGCAACAAACTG[T/G]AAGTCTACTCATCTCCTTGCTNGTTTTTTGACTTCTTGTGTTTCTACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link