atrx

Ensembl ID:
ENSDARG00000042236
ZFIN ID:
ZDB-GENE-030912-11
Description:
Atrxl protein [Source:UniProtKB/TrEMBL;Acc:Q7ZUS5]
Human Orthologue:
ATRX
Human Description:
alpha thalassemia/mental retardation syndrome X-linked [Source:HGNC Symbol;Acc:886]
Mouse Orthologue:
Atrx
Mouse Description:
alpha thalassemia/mental retardation syndrome X-linked homolog (human) Gene [Source:MGI Symbol;Acc:M

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13757 Nonsense Available for shipment Available now
sa10556 Splice Site, Nonsense Available for shipment Available now
sa15167 Nonsense Available for shipment Available now
sa17647 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 Nonsense 361 995 9 14
ENSDART00000125865 Nonsense 251 1620 3 34
ENSDART00000127594 Nonsense 361 2011 9 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 10871274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAGGCCCATGCTGCTCTGGAGGAATCGCTTGAAAATGAATTYGAAT[C/A]RAAAGGCCTCAAGTTTCAGAACGGAGAGGAGCAACGACCATCAAAMWGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 Nonsense 417 995 9 14
ENSDART00000125865 Splice Site, Nonsense 307 1620 3 34
ENSDART00000127594 Nonsense 417 2011 9 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 10871441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATTGCTCCACCAAGAACCATAAWCCTGTGGGAGAAGAGGAAACCCAG[C/T]AGGACAGTAACTTGGCTGATGTTGAGATGGAAAGCCCTCCACACTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 None None 995 None 14
ENSDART00000125865 Nonsense 1500 1620 31 34
ENSDART00000127594 Nonsense 1834 2011 32 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 10929421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGCTGTTCTTTTAGGGGCTGTCCATGCGTTTCAACCAGCCGTCTTA[T/G]TCTCAGATGGGTATGGGAGCACCAAACTCCTACTTCCCCTTCAACGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061932 None None 995 None 14
ENSDART00000125865 Essential Splice Site 1603 1620 33 34
ENSDART00000127594 Essential Splice Site 1937 2011 34 35

The following transcripts of ENSDARG00000042236 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 10933146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACACAGGGAGGCCATTTATCGTGATGTCCTCAGCAAGCAACAAACTG[T/G]AAGTCTACTCATCTCCTTGCTNGTTTTTTGACTTCTTGTGTTTCTACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zjziuz3y