pias4b

Ensembl ID:
ENSDARG00000042215
ZFIN ID:
ZDB-GENE-040426-1298
Description:
protein inhibitor of activated STAT, 4b [Source:RefSeq peptide;Acc:NP_956637]
Human Orthologue:
PIAS4
Human Description:
protein inhibitor of activated STAT, 4 [Source:HGNC Symbol;Acc:17002]
Mouse Orthologue:
Pias4
Mouse Description:
protein inhibitor of activated STAT 4 Gene [Source:MGI Symbol;Acc:MGI:2136940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11676 Nonsense Available for shipment Available now
sa18674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061905 Nonsense 139 455 3 11
ENSDART00000061905 Nonsense 139 455 3 11
Genomic Location (Zv9):
Chromosome 2 (position 57940206)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57331136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGCCATGCAAAACTCAGACTTTCTGTTTCATCTCAGTGAAAGTCAA[C/T]AGGCRCTGATCCAGAACAGCCGGTGAGTTTCTGTCGTCATTTGTGCGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061905 Nonsense 139 455 3 11
ENSDART00000061905 Nonsense 139 455 3 11
Genomic Location (Zv9):
Chromosome 2 (position 57940206)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57331136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGCCATGCAAAACTCAGACTTTCTGTTTCATCTCAGTGAAAGTCAA[C/T]AGGCRCTGATCCAGAACAGCCGGTGAGTTTCTGTCGTCATTTGTGCGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link