si:ch211-233h19.2

Ensembl ID:
ENSDARG00000042213
ZFIN ID:
ZDB-GENE-061009-14
Description:
hypothetical protein LOC565175 [Source:RefSeq peptide;Acc:NP_001082876]
Human Orthologue:
KIAA1324L
Human Description:
KIAA1324-like [Source:HGNC Symbol;Acc:21945]
Mouse Orthologue:
9330182L06Rik
Mouse Description:
RIKEN cDNA 9330182L06 gene Gene [Source:MGI Symbol;Acc:MGI:2443264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36574 Nonsense Mutation detected in F1 DNA During 2017
sa43050 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061900 Nonsense 223 1010 5 22
ENSDART00000145226 Nonsense 226 1013 5 22
Genomic Location (Zv9):
Chromosome 18 (position 8393715)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8971093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAGGATTCAAGTAATAAATGGATCAAATTGACCAATCATGGAGAGTG[G/A]GGAGCACATAGTGTAAGTAAAAAAAAAATCTTATTTATTTGATGTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061900 Essential Splice Site 511 1010 12 22
ENSDART00000145226 Essential Splice Site 514 1013 12 22
Genomic Location (Zv9):
Chromosome 18 (position 8400575)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8977953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTTGAAACCAGCTGTAAAGCCGACTGCGAGTTTTACTTTATGATGG[T/G]GAGTGTGTTCATATGGGATTGTGAAACTATTAATGTATATGGATATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link