sema3ab

Ensembl ID:
ENSDARG00000042210
ZFIN ID:
ZDB-GENE-991209-6
Description:
Semaphorin-3ab [Source:UniProtKB/Swiss-Prot;Acc:Q9W686]
Human Orthologue:
SEMA3A
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A [Source:HGNC
Mouse Orthologue:
Sema3a
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23237 Nonsense Available for shipment Available now
sa13929 Nonsense Available for shipment Available now
sa6502 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061886 Nonsense 344 778 10 17
Genomic Location (Zv9):
Chromosome 18 (position 8880919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9457895
KASP Assay ID:
2261-1874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTCTGTTTGCAGTAATATTTTTAAGGGTTCTGCGGTCTGCATGTA[C/A]AGTATGGCAGATATCAGGAGAGTGTTTTTGGGCCCATATGCCCACCGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061886 Nonsense 503 778 14 17
Genomic Location (Zv9):
Chromosome 18 (position 8883985)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9460961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYAGGGAAGTCACAGTGTCTTGGCTTTGTCTTTACAGCAACARCTCTA[T/G]CTTGGATCTGCCATCGGGGTTTCTCAGATGCCWCTTCATCGMTGTGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061886 Nonsense 729 778 17 17
Genomic Location (Zv9):
Chromosome 18 (position 8893604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9470580
KASP Assay ID:
554-4618.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGATCAGCTCTGCGAACAGGTGTGGAAGAGAGAACGCAAACAACGCAGA[C/T]AGAAAGCCAATCTACTGCACGCCAGCCAATCACACACCAGCCAGATCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link