ENSDARG00000042197

Ensembl ID:
ENSDARG00000042197

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12554 Essential Splice Site Available for shipment Available now
sa12545 Essential Splice Site Available for shipment Available now
sa7360 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061860 Essential Splice Site 117 345 3 7
ENSDART00000061860 Essential Splice Site 117 345 3 7
Genomic Location:
Chromosome 12 (position 2629408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGTTTCKCCATAAACAGCCTTTCATGGGACATCGTCATTTTTACAAA[G/A]TAAGTTGCACATTTTAGAAACATGTAATTCCTTCTWTCAGGGTTCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061860 Essential Splice Site 117 345 3 7
ENSDART00000061860 Essential Splice Site 117 345 3 7
Genomic Location:
Chromosome 12 (position 2629408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGTTTCKCCATAAACAGCCTTTCATGGGACATCGTCATTTTTACAAA[G/A]TAAGTTGCACATTTTAGAAACATGTAATTCCTTCTWTCAGGGTTCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061860 Missense 163 345 5 7
Genomic Location:
Chromosome 12 (position 2631788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCCAATCGACTWCTACATTAYTATTTAGGTTACCAAATGGATCAGC[G/T]GTGCAAACAATGGTAGCCTAGTTGTGAYGGCTTTACCTTCAAGTAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3y74nxya