paplnb

Ensembl ID:
ENSDARG00000042186
ZFIN ID:
ZDB-GENE-030131-6023
Description:
papilin b, proteoglycan-like sulfated glycoprotein [Source:RefSeq peptide;Acc:NP_001018400]
Human Orthologue:
PAPLN
Human Description:
papilin, proteoglycan-like sulfated glycoprotein [Source:HGNC Symbol;Acc:19262]
Mouse Orthologue:
Papln
Mouse Description:
papilin, proteoglycan-like sulfated glycoprotein Gene [Source:MGI Symbol;Acc:MGI:2386139]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17921 Essential Splice Site Available for shipment Available now
sa9174 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13427 Essential Splice Site Available for shipment Available now
sa11086 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061836 Essential Splice Site 186 548 7 14
ENSDART00000140287 Essential Splice Site 186 538 6 13
Genomic Location (Zv9):
Chromosome 20 (position 33547868)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33606108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACTTCTAGAYATGGACCTGGTGCTGCTGTCCATCTGGACACTTACAG[G/A]TTATTCATCACTGTTTTGTTTGTTTGTTTTTTTNGCATCTGTAATGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061836 Essential Splice Site 253 548 8 14
ENSDART00000140287 Essential Splice Site 253 538 7 13
Genomic Location (Zv9):
Chromosome 20 (position 33546183)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33604423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAAYGAACACGCCTGTGCYGAAYACAGCGCCGGCCCATTTGGTGATG[T/A]ATGGAATTATTTCATTAATATTTTATCAGTCCTTCCAGGATTTTGTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061836 Essential Splice Site 462 548 13 14
ENSDART00000140287 Essential Splice Site 452 538 12 13
Genomic Location (Zv9):
Chromosome 20 (position 33538865)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33597105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGCTCTGGGTTACAGAAGAGCGGGATGTCCTGACTCCTCCTATGGG[G/A]TAAAACAGCTCATTTAATTTTCYCTGTCAGTTTTCCTCTCATCATATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061836 Nonsense 475 548 14 14
ENSDART00000140287 Nonsense 465 538 13 13
Genomic Location (Zv9):
Chromosome 20 (position 33538737)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33596977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTGTTTTCAGGATCACAGTCCCTCTGCTAGTGTGTGCTCCTTGGCA[C/T]GAGATGTCGGGCCCTGTTATGAATATAAATCTCRCTTCTACTTTGATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link