rbbp5

Ensembl ID:
ENSDARG00000042147
ZFIN ID:
ZDB-GENE-040426-886
Description:
retinoblastoma-binding protein 5 [Source:RefSeq peptide;Acc:NP_956539]
Human Orthologue:
RBBP5
Human Description:
retinoblastoma binding protein 5 [Source:HGNC Symbol;Acc:9888]
Mouse Orthologue:
Rbbp5
Mouse Description:
retinoblastoma binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:1918367]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13180 Essential Splice Site Available for shipment Available now
sa24048 Nonsense Available for shipment Available now
sa45750 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Essential Splice Site 120 512 4 14
Genomic Location (Zv9):
Chromosome 22 (position 740033)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 743186
GRCz11 22 780909
KASP Assay ID:
2261-6190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCTTTCCSTCCCCCATCCTCAAGCTGCAGTATCACCCCCGAGACATG[T/A]GAGTGMTGTCACTTTYTCTCGYACCCGTCAACCACCGCRRCGCACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Nonsense 220 512 7 14
Genomic Location (Zv9):
Chromosome 22 (position 736935)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 740088
GRCz11 22 777811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGTGTGTGTTGTGTGCCCCCAGTTGTTTCCTCATCAACACAGCAGAT[C/T]GAATCATTCGAGTTTACGACGGTCGAGAGATCCTGACCTGCGGCAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Essential Splice Site 326 512 9 14
Genomic Location (Zv9):
Chromosome 22 (position 736161)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 739314
GRCz11 22 777037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTCCATCTCCAGCGGCGTGGTCTCCATATGGGCTCAGAACCAAGTGG[T/A]GAGAAAATCAAACAAATCAGACTGTAAAGTGTAACGTGTCACTGTAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link