rbbp5

Ensembl ID:
ENSDARG00000042147
ZFIN ID:
ZDB-GENE-040426-886
Description:
retinoblastoma-binding protein 5 [Source:RefSeq peptide;Acc:NP_956539]
Human Orthologue:
RBBP5
Human Description:
retinoblastoma binding protein 5 [Source:HGNC Symbol;Acc:9888]
Mouse Orthologue:
Rbbp5
Mouse Description:
retinoblastoma binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:1918367]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13180 Essential Splice Site Available for shipment Available now
sa24048 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Essential Splice Site 120 512 4 14
Genomic Location:
Chromosome 22 (position 740033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCTTTCCSTCCCCCATCCTCAAGCTGCAGTATCACCCCCGAGACATG[T/A]GAGTGMTGTCACTTTYTCTCGYACCCGTCAACCACCGCRRCGCACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Nonsense 220 512 7 14
Genomic Location:
Chromosome 22 (position 736935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGTGTGTGTTGTGTGCCCCCAGTTGTTTCCTCATCAACACAGCAGAT[C/T]GAATCATTCGAGTTTACGACGGTCGAGAGATCCTGACCTGCGGCAGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mmhg1j2k