myo6b

Ensembl ID:
ENSDARG00000042141
ZFIN ID:
ZDB-GENE-030318-3
Description:
myosin-VI [Source:RefSeq peptide;Acc:NP_001004110]
Human Orthologue:
MYO6
Human Description:
myosin VI [Source:HGNC Symbol;Acc:7605]
Mouse Orthologue:
Myo6
Mouse Description:
myosin VI Gene [Source:MGI Symbol;Acc:MGI:104785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2929 Essential Splice Site F2 line generated During 2014
sa18082 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2929
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042203 Essential Splice Site 185 1255 7 32
ENSDART00000061762 Essential Splice Site 185 1267 6 33
ENSDART00000088801 Essential Splice Site 185 1267 7 34
ENSDART00000131566 Essential Splice Site 185 1255 7 33
Genomic Location:
Chromosome 17 (position 36969364)
KASP Assay ID:
554-3365.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACATCTTACGGCACAGGCCAAGATATAGATGAGAGGATTGTTGAAGG[T/C]AAGTGTCTAGCACAGTACTGCATGYTCTTTTTTTGCATMTGATGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042203 Nonsense 1137 1255 31 32
ENSDART00000061762 Nonsense 1149 1267 32 33
ENSDART00000088801 Nonsense 1149 1267 33 34
ENSDART00000131566 Nonsense 1137 1255 32 33
Genomic Location:
Chromosome 17 (position 36856295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTGCTCCACCTGTCCCAGCCCGGCAACAAGAGATCGCGATGAAYCGA[C/T]AGCAGCGTTACTTCCGCATTCCCTTCATCCGSCCCGCAGACCAGTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zte0p62h