si:ch211-260g14.4

Ensembl ID:
ENSDARG00000042138
ZFIN ID:
ZDB-GENE-041014-326
Description:
Novel protein similar to vertebrate selectin L (Lymphocyte adhesion molecule 1) (SELL) [Source:UniPr
Human Orthologues:
SELE, SELL, SELP
Human Descriptions:
selectin E [Source:HGNC Symbol;Acc:10718]
selectin L [Source:HGNC Symbol;Acc:10720]
selectin P (granule membrane protein 140kDa, antigen CD62) [Source:HGNC Symbol;Acc:10721]
Mouse Orthologues:
Sele, Sell, Selp
Mouse Descriptions:
selectin, endothelial cell Gene [Source:MGI Symbol;Acc:MGI:98278]
selectin, lymphocyte Gene [Source:MGI Symbol;Acc:MGI:98279]
selectin, platelet Gene [Source:MGI Symbol;Acc:MGI:98280]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3047 Nonsense F2 line generated During 2017
sa139 Nonsense Confirmed mutation in F2 line During 2017
sa43485 Nonsense Mutation detected in F1 DNA During 2017
sa39288 Nonsense Mutation detected in F1 DNA During 2017
sa23751 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3047
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765   None 417 None 7
ENSDART00000121567 Nonsense 65 212 1 3
ENSDART00000130538   None 178 None 4
ENSDART00000133081 Nonsense 94 846 1 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33984143)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34056656
KASP Assay ID:
554-2513.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAACTGGGCGACAAATGAACCGAATAACCAGGGGACTGGAGAAGACTG[T/A]GTGGAGATTTACATCAAGAGGAACAAAGACACTGCCAAGTGGAACGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa139
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765   None 417 None 7
ENSDART00000121567 Nonsense 141 212 3 3
ENSDART00000130538   None 178 None 4
ENSDART00000133081 Nonsense 167 846 3 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33982190)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCATTTACACTATTGCAGTTGTCCAGTGCCAGCCAGTTGAAAACCCA[C/T]AGCAAGGTCTTGTGAAGTGTGACGGCGCCTTTGGAGAGTTTAACTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765   None 417 None 7
ENSDART00000121567 Nonsense 204 212 3 3
ENSDART00000130538   None 178 None 4
ENSDART00000133081   None 846 None 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33981999)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGTTTGTCAGGGTATGGACCATACTGGGTTGCTATGCATAAATTG[T/A]ACTTCACAGCTTAAAAATCATTGTTGATTCACATAACATTCATGGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765   None 417 None 7
ENSDART00000121567   None 212 None 3
ENSDART00000130538   None 178 None 4
ENSDART00000133081 Nonsense 232 846 4 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33981606)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTACAGCTGTCAAATGTCAGGCAATCATTGATGCCCCTCGTGGTTG[G/A]ACAATGATCTGCACTCATCCGCTTTCCATGAATAGCTTCAACTCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 Essential Splice Site 173 417 3 7
ENSDART00000121567   None 212 None 3
ENSDART00000130538   None 178 None 4
ENSDART00000133081 Essential Splice Site 406 846 6 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33979655)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34052168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGCACCAAACAGGGGAACTGGAGTCATATATCACCTATTTGTCATGG[T/A]ATCGTTCATTATTCACTGTACTAAGATATCTTCAGTTACTGTAAGTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link