im:7143453

Ensembl ID:
ENSDARG00000042126
ZFIN ID:
ZDB-GENE-050309-39
Description:
Im:7143453 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZM5]
Human Orthologue:
ELMO3
Human Description:
engulfment and cell motility 3 [Source:HGNC Symbol;Acc:17289]
Mouse Orthologue:
Elmo3
Mouse Description:
engulfment and cell motility 3, ced-12 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2679007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32524 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061738 Essential Splice Site 557 715 17 20
Genomic Location (Zv9):
Chromosome 25 (position 17827947)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17371811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAATGCTAAAGAAACCACATTAGCAATTATTGTGTGGTTGTGTTTCC[A/G]GACAAGCTGTGGTACTGTCGACTCTCTCCTAACCATAAAGTGCTGCACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link