LOC563543

Ensembl ID:
ENSDARG00000042111
Human Orthologue:
INPP5B
Human Description:
inositol polyphosphate-5-phosphatase, 75kDa [Source:HGNC Symbol;Acc:6077]
Mouse Orthologue:
Inpp5b
Mouse Description:
inositol polyphosphate-5-phosphatase B Gene [Source:MGI Symbol;Acc:MGI:103257]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12274 Essential Splice Site Available for shipment Available now
sa36025 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22739 Nonsense Available for shipment Available now
sa22740 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061706 Essential Splice Site 78 907 3 23
Genomic Location (Zv9):
Chromosome 16 (position 5066348)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4284150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCTGGGCCAAATCATTCCCATTTCTTATGACTTTTCGGTTGTTGAAG[G/A]TAAGACATATTGAGTTAATMGRTCACACTTTACWATAAGGTTCATTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061706 Essential Splice Site 287 907 10 23
Genomic Location (Zv9):
Chromosome 16 (position 5091283)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4308285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATGAGTTAGCACAGTTATGTGATTGGGATGTGTTTTCCTCCGGTA[G/A]TTTCCAGGAGCTGGATCTCAGCAAGGAGGCGTTTCTCTTCAATGACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061706 Nonsense 413 907 12 23
Genomic Location (Zv9):
Chromosome 16 (position 5099200)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4316197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTCGCAATCAAGACTTTAAAGACATCTGTCGCAGAATTCAGTTCAGA[C/T]AGGAGGATCCCACATTACCACCCCTCACCATCCTCAAACACAAGTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061706 Essential Splice Site 583 907 16 23
Genomic Location (Zv9):
Chromosome 16 (position 5105838)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4322829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACTGGAGAACGACTGCATCCCTTCAGTATCTCTGTCTGAGAGAGAGG[T/C]CAGCACATCTCAGCTTCTTACGTCATACCAAGTTTGTGGATGACCGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link