eef2a.1

Ensembl ID:
ENSDARG00000042094
ZFIN ID:
ZDB-GENE-050522-500
Description:
eukaryotic translation elongation factor 2a, tandem duplicate 1 [Source:RefSeq peptide;Acc:NP_00103
Human Orthologue:
EEF2
Human Description:
eukaryotic translation elongation factor 2 [Source:HGNC Symbol;Acc:3214]
Mouse Orthologue:
Eef2
Mouse Description:
eukaryotic translation elongation factor 2 Gene [Source:MGI Symbol;Acc:MGI:95288]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29761 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29762 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024751 Essential Splice Site 204 854 None 13
ENSDART00000110200 Essential Splice Site None 160 None 15
ENSDART00000143641 Essential Splice Site 204 854 None 13
Genomic Location (Zv9):
Chromosome 22 (position 20457353)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20114046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCACCTATGCTGAGGATGAGAAAGGCCCTATGGGCAATGTCATGG[T/C]GAGTGCCTCAAGGCTCCGTCATGGGTCCATTAATGCTTTCTGTTTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024751 Nonsense 637 854 10 13
ENSDART00000110200   None 160 12 15
ENSDART00000143641 Nonsense 637 854 10 13
Genomic Location (Zv9):
Chromosome 22 (position 20459413)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20116106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCCAGCCAGGAGATGAATGCCCGTGCCCAATACCTTGCTGAAAACTA[T/A]AAGTGGGAAGTGACTGAAGCTCGTAAGATCTGGTGCTTTGGCCCTGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link