dmap1

Ensembl ID:
ENSDARG00000042087
ZFIN ID:
ZDB-GENE-040426-748
Description:
DNA methyltransferase 1-associated protein 1 [Source:RefSeq peptide;Acc:NP_956549]
Human Orthologue:
DMAP1
Human Description:
DNA methyltransferase 1 associated protein 1 [Source:HGNC Symbol;Acc:18291]
Mouse Orthologue:
Dmap1
Mouse Description:
DNA methyltransferase 1-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913483]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15668 Essential Splice Site Available for shipment Available now
sa21249 Nonsense Available for shipment Available now
sa34365 Nonsense Mutation detected in F1 DNA During 2017
sa17091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061679 Essential Splice Site 64 464 3 11
Genomic Location (Zv9):
Chromosome 8 (position 18885154)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18330042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGAATGCACAGRGAAGTTTACGCTTTGCTGTATTCAGACAAAAAG[T/G]AAGATGTATTGGTTTAACCTTTNCCACACCACTGCTTTATTACTTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061679 Nonsense 79 464 4 11
Genomic Location (Zv9):
Chromosome 8 (position 18884516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18329404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTCGGGATGCCCCTCCACTTTTGCCGAGCGACACTACACAAGGCTA[T/A]CGGACAGTTAAAGCCAAACTGGGCTGTAAGAAAGTGCGGCCCTGGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061679 Nonsense 133 464 5 11
Genomic Location (Zv9):
Chromosome 8 (position 18883606)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18328494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGAAGCTTTTTTTTAATGACAATTTCCTTGCTGATTCAAGACTGTG[C/T]AGGTGCCTGTGTACTCAGAACAGGAGTATCAGATGTATCTTCATGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061679 Nonsense 407 464 10 11
Genomic Location (Zv9):
Chromosome 8 (position 18878111)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18322999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKCGGMACCGTTATGATGCACTGATAAAAGCAGGGGGCGCCGTCACACCA[C/T]ARAGYGAAAGTGGTGGMGGCCTGGACAGTCAAWCCTGGCCCTGTGCTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link