prpf39

Ensembl ID:
ENSDARG00000042080
ZFIN ID:
ZDB-GENE-030616-420
Description:
Pre-mRNA-processing factor 39 [Source:UniProtKB/Swiss-Prot;Acc:Q1JPZ7]
Human Orthologue:
PRPF39
Human Description:
PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20314]
Mouse Orthologue:
Prpf39
Mouse Description:
PRP39 pre-mRNA processing factor 39 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:104602]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13245 Nonsense Available for shipment Available now
sa23828 Nonsense Available for shipment Available now
sa6660 Nonsense Mutation detected in F1 DNA During 2017
sa23827 Essential Splice Site Available for shipment Available now
sa37189 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061672 Nonsense 46 752 2 14
ENSDART00000135114 Nonsense 46 391 2 13

The following transcripts of ENSDARG00000042080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 54632876)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54481354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGGACTGATGATGTCACAGGCTTGAGCACGTCCGATTTGACGACAGAA[C/T]AACCCCCAGAAAGCCAGGAGCAGACCCAGCCGGTGTCCGACATGGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061672 Nonsense 152 752 2 14
ENSDART00000135114 Nonsense 152 391 2 13

The following transcripts of ENSDARG00000042080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 54632556)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54481674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAGCAGATCCAGCGGCGCCACAAGAACCAGAACTTCCCACAGAATA[T/G]GAGCGTTTGTCCAAGGTTGTGGAAGATAATCCTGAAGACTTCAATGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061672 Nonsense 283 752 5 14
ENSDART00000135114 Nonsense 283 391 5 13

The following transcripts of ENSDARG00000042080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 54623533)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54490697
KASP Assay ID:
554-4738.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTGGCCTGYGGGACAGATTTCCGCTCGGACCGTCTGTGGGAGGCTTA[T/A]ATCGCATGGGAGACGGAGCAAGGGAAGCTGGCCAATGTCACCGCCATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061672 Essential Splice Site 317 752 None 14
ENSDART00000135114 Essential Splice Site 317 391 None 13

The following transcripts of ENSDARG00000042080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 54623430)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54490800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTCTGCTCTGCATTCCCACACAGCTGTACTCGCAGCATTTCCAGAAG[T/C]GAGTGTCCGACACAGCACATGTTAGAGCTGTACGATAGTGGAGAGATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061672 Nonsense 615 752 11 14
ENSDART00000135114   None 391 10 13

The following transcripts of ENSDARG00000042080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 54610452)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54503778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGACGAACCCGAAGCTGTACCTGAATCTGCTGGAGCTGGAGTACAGC[G/T]GAGACGTGCAGCAGAACGAAGCTGAAATCATCGCCTGTTTCGACCGCGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link