eef2a.2

Ensembl ID:
ENSDARG00000042065
ZFIN ID:
ZDB-GENE-050208-348
Description:
eukaryotic translation elongation factor 2a, tandem duplicate 2 [Source:RefSeq peptide;Acc:NP_00103
Human Orthologue:
EEF2
Human Description:
eukaryotic translation elongation factor 2 [Source:HGNC Symbol;Acc:3214]
Mouse Orthologue:
Eef2
Mouse Description:
eukaryotic translation elongation factor 2 Gene [Source:MGI Symbol;Acc:MGI:95288]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24152 Essential Splice Site Available for shipment Available now
sa7985 Nonsense Mutation detected in F1 DNA During 2016
sa32399 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Essential Splice Site 203 853 3 12
ENSDART00000137624 Essential Splice Site 204 853 4 13
Genomic Location:
Chromosome 22 (position 20469753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCACCTATGCTGAGGATGAGAAAGGCCCTATGGGCAACGTCATGG[T/G]GAGTGCCTCAAGGCTCCGTCATGGGTCCTTTAATGCTTTCTGTTTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Nonsense 536 853 8 12
ENSDART00000137624 Nonsense 537 853 9 13
Genomic Location:
Chromosome 22 (position 20471257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGATTGAAGCATCTGGCCAAGTCAGATCCCATGTTGCAATGCATCTTC[G/T]AGGATTCTGGTGAGCATATCATTGCTGGAGCTGGTGAGCTTCACTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Essential Splice Site 747 853 10 12
ENSDART00000137624 Essential Splice Site 745 853 11 13
Genomic Location:
Chromosome 22 (position 20472325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGCTGAACCAAGGCTTAGTGAGCCGGTATACCTGGTGGAGATGCAG[G/T]TATAAAAGTAGCATTAAAACTCCTGCTCATTGATCTTTTGGTATTTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link