eef2a.2

Ensembl ID:
ENSDARG00000042065
ZFIN ID:
ZDB-GENE-050208-348
Description:
eukaryotic translation elongation factor 2a, tandem duplicate 2 [Source:RefSeq peptide;Acc:NP_00103
Human Orthologue:
EEF2
Human Description:
eukaryotic translation elongation factor 2 [Source:HGNC Symbol;Acc:3214]
Mouse Orthologue:
Eef2
Mouse Description:
eukaryotic translation elongation factor 2 Gene [Source:MGI Symbol;Acc:MGI:95288]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24152 Essential Splice Site Available for shipment Available now
sa32399 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Essential Splice Site 203 853 3 12
ENSDART00000137624 Essential Splice Site 204 853 4 13
Genomic Location (Zv9):
Chromosome 22 (position 20469753)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20126446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCACCTATGCTGAGGATGAGAAAGGCCCTATGGGCAACGTCATGG[T/G]GAGTGCCTCAAGGCTCCGTCATGGGTCCTTTAATGCTTTCTGTTTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Essential Splice Site 747 853 10 12
ENSDART00000137624 Essential Splice Site 745 853 11 13
Genomic Location (Zv9):
Chromosome 22 (position 20472325)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20129018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGCTGAACCAAGGCTTAGTGAGCCGGTATACCTGGTGGAGATGCAG[G/T]TATAAAAGTAGCATTAAAACTCCTGCTCATTGATCTTTTGGTATTTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link