eef2a.2

Ensembl ID:
ENSDARG00000042065
ZFIN ID:
ZDB-GENE-050208-348
Description:
eukaryotic translation elongation factor 2a, tandem duplicate 2 [Source:RefSeq peptide;Acc:NP_00103
Human Orthologue:
EEF2
Human Description:
eukaryotic translation elongation factor 2 [Source:HGNC Symbol;Acc:3214]
Mouse Orthologue:
Eef2
Mouse Description:
eukaryotic translation elongation factor 2 Gene [Source:MGI Symbol;Acc:MGI:95288]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24152 Essential Splice Site Available for shipment Available now
sa7985 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Essential Splice Site 203 853 3 12
ENSDART00000137624 Essential Splice Site 204 853 4 13
Genomic Location:
Chromosome 22 (position 20469753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCACCTATGCTGAGGATGAGAAAGGCCCTATGGGCAACGTCATGG[T/G]GAGTGCCTCAAGGCTCCGTCATGGGTCCTTTAATGCTTTCTGTTTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036757 Nonsense 536 853 8 12
ENSDART00000137624 Nonsense 537 853 9 13
Genomic Location:
Chromosome 22 (position 20471257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGATTGAAGCATCTGGCCAAGTCAGATCCCATGTTGCAATGCATCTTC[G/T]AGGATTCTGGTGAGCATATCATTGCTGGAGCTGGTGAGCTTCACTTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/awkpj0rp