si:ch211-145c1.1

Ensembl ID:
ENSDARG00000042063
ZFIN ID:
ZDB-GENE-070912-81
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5U5]
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17563 Nonsense Available for shipment Available now
sa21434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102739 Nonsense 27 213 3 9
ENSDART00000123069 Nonsense 29 307 2 11
ENSDART00000139867 Nonsense 39 225 3 9
Genomic Location (Zv9):
Chromosome 9 (position 8336738)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8316581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTRACTGCCTTACAGCTGCRCTTCTATTTCAGACGTCGTAATAACGTG[T/A]ACSGATTCTGACCTTCATCTAAAATGTGGTAAGATGAAGTCATGCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102739   None 213 None 9
ENSDART00000123069 Essential Splice Site 215 307 8 11
ENSDART00000139867   None 225 None 9
Genomic Location (Zv9):
Chromosome 9 (position 8327553)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8307396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTATTTCCTTATCAGGTCATTCTTGTTTCTTTCTCTATTGTCTTAC[A/T]GAATCAATTGTAGCTTGTGAAGGTGACCAAATTGACTTGGAATGGGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link