hmg20b

Ensembl ID:
ENSDARG00000042045
ZFIN ID:
ZDB-GENE-030131-4258
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-relate
Human Orthologue:
HMG20B
Human Description:
high-mobility group 20B [Source:HGNC Symbol;Acc:5002]
Mouse Orthologue:
Hmg20b
Mouse Description:
high mobility group 20 B Gene [Source:MGI Symbol;Acc:MGI:1341190]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17207 Essential Splice Site Available for shipment Available now
sa24153 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061617 Essential Splice Site None 301 2 9
Genomic Location:
Chromosome 22 (position 20490345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTAGTCTTTTATATTTCATCTAAAYATATTTTCTTTTTTGYCTTCCC[A/C]GAATTCCGTGAATCCACGTTATGGGTGGTGTAAAGCAAGAGCAGACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061617 Nonsense 233 301 7 9
Genomic Location:
Chromosome 22 (position 20493727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCCTGGAAGCTGAGCTAGGCCAAGATGAGCTTCGTACGCAGGCCCTA[C/T]AGCGCCACCTACAGGCTATCAAACAGACGCTAGTCAGCAGCTTGGCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1uxvutda