hmg20b

Ensembl ID:
ENSDARG00000042045
ZFIN ID:
ZDB-GENE-030131-4258
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-relate
Human Orthologue:
HMG20B
Human Description:
high-mobility group 20B [Source:HGNC Symbol;Acc:5002]
Mouse Orthologue:
Hmg20b
Mouse Description:
high mobility group 20 B Gene [Source:MGI Symbol;Acc:MGI:1341190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17207 Essential Splice Site Available for shipment Available now
sa29763 Nonsense Mutation detected in F1 DNA During 2015
sa24153 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061617 Essential Splice Site None 301 2 9
Genomic Location:
Chromosome 22 (position 20490345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTAGTCTTTTATATTTCATCTAAAYATATTTTCTTTTTTGYCTTCCC[A/C]GAATTCCGTGAATCCACGTTATGGGTGGTGTAAAGCAAGAGCAGACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061617 Nonsense 18 301 2 9
Genomic Location:
Chromosome 22 (position 20490417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGGTGTAAAGCAAGAGCAGACTGATGCTCCTGCATCTAAAGACTCT[C/T]AGCAGACTGATTCGCCACAGGAAGAGGTTAGATACAGACTGCTTTAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061617 Nonsense 233 301 7 9
Genomic Location:
Chromosome 22 (position 20493727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCCTGGAAGCTGAGCTAGGCCAAGATGAGCTTCGTACGCAGGCCCTA[C/T]AGCGCCACCTACAGGCTATCAAACAGACGCTAGTCAGCAGCTTGGCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1uxvutda