pou3f3a

Ensembl ID:
ENSDARG00000042032
ZFIN ID:
ZDB-GENE-980526-220
Description:
POU domain, class 3, transcription factor 3-A [Source:UniProtKB/Swiss-Prot;Acc:P56224]
Human Orthologues:
POU3F1, POU3F3
Human Descriptions:
POU class 3 homeobox 1 [Source:HGNC Symbol;Acc:9214]
POU class 3 homeobox 3 [Source:HGNC Symbol;Acc:9216]
Mouse Orthologues:
Pou3f1, Pou3f3
Mouse Descriptions:
POU domain, class 3, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101896]
POU domain, class 3, transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:102564]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38722 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061593 Nonsense 140 446 1 2
ENSDART00000113914 Nonsense 140 438 1 2
ENSDART00000133178 Nonsense 140 429 1 1
Genomic Location (Zv9):
Chromosome 9 (position 6701713)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6682669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAACAGGGAAGACCTACACTCGGGCACCGCTTTGCACCACAGACCCT[C/A]GCATTTAGGGGCTCACCAGTCGCACCAAAGCGCATGGGGTGGCACCACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link