gorab

Ensembl ID:
ENSDARG00000042031
ZFIN ID:
ZDB-GENE-040426-1384
Description:
RAB6-interacting golgin [Source:UniProtKB/Swiss-Prot;Acc:Q7T320]
Human Orthologue:
GORAB
Human Description:
golgin, RAB6-interacting [Source:HGNC Symbol;Acc:25676]
Mouse Orthologue:
Gorab
Mouse Description:
golgin, RAB6-interacting Gene [Source:MGI Symbol;Acc:MGI:2138271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14159 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061592 Nonsense 248 336 5 5
ENSDART00000139739 None None 190 None 3
ENSDART00000143765 Nonsense 264 352 5 5
Genomic Location:
Chromosome 20 (position 34530913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCGAGGTGAAAGAGCAGCTGACAGAGCACCTGTGTGCAATCATCCAA[C/T]AGAACGAGCTGCGCAAGGCCCGCAAACTGGAAGAGCTGATGCTGCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bc5hxz5x