kpna5

Ensembl ID:
ENSDARG00000042030
ZFIN ID:
ZDB-GENE-050522-22
Description:
Importin subunit alpha-6 [Source:UniProtKB/Swiss-Prot;Acc:Q503E9]
Human Orthologue:
KPNA5
Human Description:
karyopherin alpha 5 (importin alpha 6) [Source:HGNC Symbol;Acc:6398]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39113 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102027 Essential Splice Site 418 539 12 14
Genomic Location (Zv9):
Chromosome 16 (position 34485445)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32216945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGGCGATAACCAACGCCACTTCAGGAGGCACACCAGAGCAGATCAGG[T/C]ACACTGTGGGCTCTTGCTGTGGGTTTTACCTTGTTCTCAGAGTTTAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Telomere length: A genome-wide association study identifies a locus on chromosome 14q21 as a predictor of leukocyte telomere length and as a marker of susceptibility for bladder cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link