prrx1b

Ensembl ID:
ENSDARG00000042027
ZFIN ID:
ZDB-GENE-030131-9033
Description:
paired mesoderm homeobox 1b [Source:RefSeq peptide;Acc:NP_956344]
Human Orthologue:
PRRX1
Human Description:
paired related homeobox 1 [Source:HGNC Symbol;Acc:9142]
Mouse Orthologue:
Prrx1
Mouse Description:
paired related homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:97712]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37097 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061588 Essential Splice Site 83 245 2 4
ENSDART00000131637 Essential Splice Site 55 212 2 5
Genomic Location (Zv9):
Chromosome 20 (position 34539776)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34612289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAAAGCTCCAGCTCCTTAGGTAACTAACTGTACATGTGTGTGTATAC[A/T]GATGAGCAGCTGAACTCAGAAGAAAAGAAGAAGCGGAAACAGCGGAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link