fhl2a

Ensembl ID:
ENSDARG00000042018
ZFIN ID:
ZDB-GENE-040808-49
Description:
four and a half LIM domains 2a [Source:RefSeq peptide;Acc:NP_001003732]
Human Orthologue:
FHL2
Human Description:
four and a half LIM domains 2 [Source:HGNC Symbol;Acc:3703]
Mouse Orthologue:
Fhl2
Mouse Description:
four and a half LIM domains 2 Gene [Source:MGI Symbol;Acc:MGI:1338762]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41350 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061577 Nonsense 114 279 4 6
ENSDART00000122279 Nonsense 114 165 4 4
Genomic Location (Zv9):
Chromosome 9 (position 6638521)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6619477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACACATTATGGATAAGATGGCTCTCTTCCTCTCCCTCAGGCTCCAGG[A/T]AGATGGAGCATAAAGGAAACAGCTGGCATGAGACCTGCTTTACCTGCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link