PKLR

Ensembl ID:
ENSDARG00000042010
Description:
pyruvate kinase, liver and RBC [Source:HGNC Symbol;Acc:9020]
Human Orthologue:
PKLR
Human Description:
pyruvate kinase, liver and RBC [Source:HGNC Symbol;Acc:9020]
Mouse Orthologue:
Pklr
Mouse Description:
pyruvate kinase liver and red blood cell Gene [Source:MGI Symbol;Acc:MGI:97604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7300 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075275 Nonsense 99 537 5 14
ENSDART00000115024 Nonsense 99 535 5 14
Genomic Location (Zv9):
Chromosome 16 (position 57898505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54633143
KASP Assay ID:
554-4658.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTACAGCACTGAGCTGGTTTGAGGACATGTCTGAKGTCCTGATARTTA[C/T]GAATGCTTAAAAATAATTTGAGCACTCAGGTTGTCCACAGGTGTGTGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link