elp3

Ensembl ID:
ENSDARG00000042005
ZFIN ID:
ZDB-GENE-050327-35
Description:
Elongator complex protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5RIC0]
Human Orthologue:
ELP3
Human Description:
elongation protein 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20696]
Mouse Orthologue:
Elp3
Mouse Description:
elongation protein 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1921445]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061557 Essential Splice Site 8 548 None 15
ENSDART00000138226 Essential Splice Site None 528 None 15
Genomic Location:
Chromosome 20 (position 34696155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGTGTTTGTAGATTKTGTMWAAGATGGGAAAGCCAAAAAAGAAGAG[T/A]AAGTATTATTTGCTCATTTTTANCATGGCGTATTCTGTTACGTTGCTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqzu2g71